• Question: Do you do any DNA tracing on animals I rescued a beagle dog and would it be possible to see what presentage beagle she is

    Asked by hays49dug to Suzy on 27 Nov 2020.
    • Photo: Suzy Whoriskey

      Suzy Whoriskey answered on 27 Nov 2020:

      That sounds like a great idea to find out her exact breed – also very jealous of your new dog!
      I don’t actually sequence DNA myself – that’s a very difficult and complex job, and is for geneticists. I’m a statistician (specialising in statistical genetics) which means I work with data, but my data is genetic data.
      So what happens to me is that someone sends me the DNA sequences, this is usually in the form of a big massive data set where each person has a long string of nucleotides, these are represented by the letters T,C,A and G. So the data mostly looks like:
      AGCTGTATATTTGCGCCCATATT… (there are around 3 billion of these letters).
      And I compare this with other people’s to look for patterns.
      You could definitely find out your dog’s exact breed though, just sorry I can’t do it!

Comments